mbd3 flox cell line (Addgene inc)
Structured Review

Mbd3 Flox Cell Line, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mbd3+flox+cell+line/mouse+Oct4-GFP+GOF18+transgenic+reporter+(Plasmid+%2360527)/pmc07116536-1081-6-32
Average 93 stars, based on 9 article reviews
Images
1) Product Images from "Neutralizing Gatad2a-Chd4-Mbd3/NuRD Complex Facilitates Deterministic Induction of Naïve Pluripotency"
Article Title: Neutralizing Gatad2a-Chd4-Mbd3/NuRD Complex Facilitates Deterministic Induction of Naïve Pluripotency
Journal: Cell stem cell
doi: 10.1016/j.stem.2018.07.004
Figure Legend Snippet: A. MEFs harboring TetO-OKSM and M2rtTA cassettes were transfected with siRNA targeting different canonical NuRD components (indicated in the illustration), 2 and 4 days after reprogramming initiation following DOX administration. Reprogramming was then evaluated by AP staining at day 8. B. Reprograming efficiency following siRNA treatments was evaluated using AP staining, after 8 days of reprogramming (n=3, two-sided Student’s t-test p values are indicated). C. Cell growth curves of MEFs treated with siRNA for the indicated NuRD components (two-sided Student’s t-test p values are indicated). D. Representative images of cells treated with siRNA targeting Mbd3 or Gatad2a and exposed to BrdU in order to evaluate proliferation. E. Quantitative evaluation of BrdU incorporation test (n=8, two-sided Student’s ttest p values are indicated Student’s t-test). F. Viability and apoptosis induction were measured using FACS following Annexin-PI staining. G. Reprogramming efficiency following siRNA treatments targeting different NuRD components, at different time points. KD was performed at two distinct cycles: the early one (Regimen 1, marked in black) started one day prior to DOX induction, and the second one (Regimen 2, marked in grey) started one day post-DOX induction. H. iPSC reprogramming efficiency following different siRNA treatments. was evaluated at day 8. (n=3 per each condition, two-sided Student’s t-test p values are indicated).
Techniques Used: Transfection, Staining, BrdU Incorporation Assay
Figure Legend Snippet: A. Scheme demonstrating strategy for generating secondary isogenic Gatad2a WT and KO lines, and comparing their reprogramming efficiency side by side. 2i/LIF-KSR conditions were introduced at day 3.5 during the 8-day course. More detailed information is provided in Fig. S2A. B. Targeting scheme of Gatad2a locus. C. Western blot validation of Gatad2a levels. D. Representative images of Gatad2a-/- iPSC derived E13.5 chimera. Red arrow highlights mCherry+ chimera which originates from mCherry labeled iPSCs that were microinjected. E. Bulk iPSC reprogramming as in F, but experiment was terminated after 6 days and iPSC colony formation was evaluated by Alkaline Phosphatase staining (AP+). F. Representative flow cytometry measurements of ΔPE-Oct4-GFP reactivation dynamics in polyclonal/bulk Gatad2a-WT and Gatad2a-KO isogenic cell lines. G. Representative summaries of single-cell iPSC reprogramming efficiency experiment. Secondary isogenic Gatad2a WT and KO reprogrammable MEFs carrying constitutively expressed mCherry-NLS and naïve pluripotency specific ΔPE-Oct4-GFP reporter were sorted and seeded as single-cell per well. Reprogramming was initiated by DOX administration according to panel A. Reprogramming efficiency was assessed after 8 days based on the number of wells in which mCherry+ cells formed an ΔPE-Oct4-GFP positive colony. H. The indicated secondary Gatad2a+/+ and Gatad2a-/- somatic cell types were isolated and subjected reprogramming and evaluation of iPSC efficiency following 8 days of DOX.
Techniques Used: Western Blot, Derivative Assay, Labeling, Staining, Flow Cytometry, Isolation
Figure Legend Snippet: A. Representative images of isogenic Gatad2a+/+; OG2-ΔPE-Oct4-GFP and Gatad2a-/-OG2-ΔPE-Oct4-GFP ESCs FBS/LIF and 2i/LIF conditions. (scale bar=100μM). B. Representative immunostaining of Gatad2a-KO ES. (Scale bar=100μM). C. Western blot comparing pluripotency proteins’ level between Gatad2a-WT and KO isogenic ES lines. D. Isogenic Gatad2a+/+ and Gatad2a-/- ESCs were maintained on Gelatin coated plates in FBS/LIS or FBS only conditions for 5 passages and then subjected to FACS analysis for OG2-ΔPE-Oct4-GFP levels. E. Priming of Gatad2a+/+ and Gatad2a-/- naïve ESCs harboring OG2-ΔPE-Oct4-GFP reporter by changing conditions from 2i/LIF to Fgf2/Activin was performed. F. Transcriptional expression of different pluripotency and differentiation markers before and after Fgf2/Activin exposure, in isogenic Gatad2a+/+ and Gatad2a-/- ESCs, presented as a relative expression column scheme. G. Gatad2a-KO ESCs generate mature teratomas. H. Strategy for generating isogenic Gatad2aflox/flox ΔPE-Oct4-GFP was established from parental cells expanded for 8 passages in FGF2/Activin and was validated for priming by FACS and RT-PCR analysis. Established Gatad2aflox/flox; OG2-ΔPE-Oct4-GFP was treated with Tat-CRE, and sub cloned isogenic Gatad2aΔ/Δ EpiSC lines were derived and used for analysis within additional 5 passages of their sub cloning. I. Reprogramming efficiency and quantification for EpiSC reprogramming from different mutant EpiSC lines. Rescue Gatad2a-Tg or control Mock-Tg were ectopically expressed in Gatad2aΔ/Δ EpiSC and included in the analysis. (n=3 per time point, p Value<0.0001, two-sided Student’s t-test).
Techniques Used: Immunostaining, Western Blot, Expressing, Reverse Transcription Polymerase Chain Reaction, Clone Assay, Derivative Assay, Subcloning, Mutagenesis
Figure Legend Snippet: A. Mass spectrometry analysis of NuRD complex components binding efficiency to Mbd3 in Gatad2a-KO and its isogenic Gatad2a-WT line, in MEF cells during reprogramming by OKSM. Only putative NuRD components are presented. B. Flag-Mbd3 CoIP in Gatad2a-WT and Gatad2a-KO cells. Experiments were conducted both in MEF cells and ESs. C. Cells during reprogramming were treated with siRNA targeting Gatad2a, and pellets collected after four days. CoIP of Chd4 shows that siGatad2a prevents Mbd3 binding to Gatad2a but also to Chd4. D. Gatad2a-KO MEF with overexpression of Gatad2a (transgenic recovery; abbreviated as Gatad2a-Tg) or Mock were subjected to Chd4-CoIP. E. The coiled coil region of Mbd3 is highly conserved between different organisms, and different proteins in the MBD family. The highlighted amino acids are crucial for Gatad2a binding to Mbd2 or Mbd3. F. A scheme of Flag tagged Mbd3, and mutant forms of Mbd3: lacking the Coiled coil region (ΔCCR-Mbd3) or the methyl-binding domain (ΔMBD-Mbd3). G. WT-Mbd3 and both mutants were over-expressed in 293T cells and were subjected to Flag-Mbd3 CoIP to examine their protein interactions. H-I. Mbd3fl/- secondary MEF, harboring ΔPE-Oct4-GFP reporter, were transfected with two different forms of Flag tagged WT-Mbd3 and ΔCCR-Mbd3. The cells were then subjected to reprogramming. (two-sided Student’s t-test, n=3. p Value<0.0001).
Techniques Used: Mass Spectrometry, Binding Assay, Over Expression, Transgenic Assay, Mutagenesis, Transfection
Figure Legend Snippet: A. Rosa26-M2rtTA Col1a:TetO-2XFlag-Mbd3 ES cells were subjected to different differentiation protocols, and cells from 5 distinct states (naïve ESC, EpiLC, EBs, MEF, 4-day OKSM Reprogramming) were subsequently subjected to CoIP with anti-Flag-Mbd3. Lysates were then analyzed by western blot, and reacted with different antibodies against different NuRD components, pluripotency factors, and other epigenetic proteins. B. Rosa26-M2rtTA Col1a:TetO-2XFlag-Mbd3 ES cells were either maintained in ground state naïve conditions or in priming condition. Lysates were subjected to Co-IP with anti-Flag-Mbd3 and examined by Western blot. Oct4 protein binding to Mbd3 can be detected only in the primed pluripotent state. C. Mbd3 expression in ES cells treated with growth media containing different small molecules, after 72 hours of treatment. D. PKCi Go6983 effect on Mbd3 level is seen after approximately 48 hours, in different concentration. E. Western blot showing Mbd3 protein levels in V6.5 ESCs expanded in different conditions. F. Western blot analysis for different NuRD components in ESC cells with and without Go6983. G. Mbd3 levels in MEFs following treatment with Go6983. H. RT-PCR analysis for Mbd3 transcript abundance following Go6983 treatment. I. Go6983 causes mild depletion in Mbd3 in MEFs following 3 days of OKSM expression. J. Gatad2a+/+ WT MEFs carrying ΔPE -Oct4-GFP reporter and constitutive mCherry markers (secondary system i) were subjected to iPSC reprogramming protocols in in Fig. 2A and iPSC efficiency was quantified at day 8. In the last two conditions included in the panel, the MEFs were pre-treated with control and Ubc9 shRNA following with Neomycin selection (Cheloufi et al., 2015), and then subjected to DOX mediated iPSC reprogramming. K. WT EpiSCs reversion efficiency to naïve ESCs in different conditions. Anova test P values are indicated. L. Isogenic WT and Gatad2a KO ESCs were expanded on feeder free plates in N2B27 LIF only or LIF/PKCi conditions. Phase images and Oct4-GFP signal maintenance are shown after 8 passages (P8).
Techniques Used: Western Blot, Co-Immunoprecipitation Assay, Protein Binding, Expressing, Concentration Assay, Reverse Transcription Polymerase Chain Reaction, shRNA, Selection
Figure Legend Snippet: A. ES cells treated with naïve ground state condition were treated with shRNA targeting Ubc9 or Scramble. Cells were lysed and subsequent CoIP of Chd4 shows a decrease in Gatad2a binding. B. Western blot analysis for protein abundance before and after knockdown of Ubc9 in ESCs. C. 2-d08 specific small molecule inhibitor for SUMOylation was applied, and co-IP experiments of Mbd3 shows a decrease in Gatad2a and Chd4 binding. D. Cells induced in naïve ground state 2i/LIF conditions and subsequent shRNA targeting either for Ubc9 or scramble negative control. The cells were lysed and fractioned – Cytoplasm, Nucleoplasm and Chromatin fractions, proteins were analyzed by western blot. E. As in D, with immunoblot for SUMO2/3 on the same exact gel series. F. Schematic representation of Gatad2a known domains and functionally validated SUMOylation sites. G. Western blot analysis for Gatad2a protein expression following lentiviral infection in Gatad2a-/- MEFs. H. Representative FACS images for reprogramming efficiency following Mock, Gatad2a-WT and Gatad2a-MUT (K30R, K485R) lentiviral infection of Gatad2a-/- secondary MEFs. I. Quantitative summary of results for experiment elucidated in H.
Techniques Used: shRNA, Binding Assay, Western Blot, Co-Immunoprecipitation Assay, Negative Control, Expressing, Infection
Figure Legend Snippet: List of RT-PCR primers used in this study.
Techniques Used: Recombinant, Protease Inhibitor, Sample Prep, Methylation, Knock-In, Negative Control, Reverse Transcription Polymerase Chain Reaction, Software
Related Articles
Transgenic Assay:Article Title: Neutralizing Gatad2a-Chd4-Mbd3/NuRD Complex Facilitates Deterministic Induction of Naïve Pluripotency Article Snippet: .. Secondary mouse embryonic fibroblast (MEF) from Article Title: High-Resolution Dissection of Conducive Reprogramming Trajectory to Ground State Pluripotency Article Snippet: .. Secondary mouse embryonic fibroblast (MEF) from Article Title: Neutralizing Gatad2a-Chd4-Mbd3 Axis within the NuRD Complex Facilitates Deterministic Induction of Naïve Pluripotency Article Snippet: .. Secondary mouse embryonic fibroblast (MEF) from Article Title: Deterministic Somatic Cell Reprogramming Involves Continuous Transcriptional Changes Governed by Myc and Epigenetic-Driven Modules Article Snippet: .. Secondary mouse embryonic fibroblast (MEF) from Plasmid Preparation:Article Title: Neutralizing Gatad2a-Chd4-Mbd3/NuRD Complex Facilitates Deterministic Induction of Naïve Pluripotency Article Snippet: .. Secondary mouse embryonic fibroblast (MEF) from Article Title: High-Resolution Dissection of Conducive Reprogramming Trajectory to Ground State Pluripotency Article Snippet: .. Secondary mouse embryonic fibroblast (MEF) from Article Title: Neutralizing Gatad2a-Chd4-Mbd3 Axis within the NuRD Complex Facilitates Deterministic Induction of Naïve Pluripotency Article Snippet: .. Secondary mouse embryonic fibroblast (MEF) from Article Title: Deterministic Somatic Cell Reprogramming Involves Continuous Transcriptional Changes Governed by Myc and Epigenetic-Driven Modules Article Snippet: .. Secondary mouse embryonic fibroblast (MEF) from other:Article Title: Neutralizing Gatad2a-Chd4-Mbd3/NuRD Complex Facilitates Deterministic Induction of Naïve Pluripotency Article Snippet: Cells were transfected (Xfect, Clontech) with Cas9-sgRNA Gatad2a (CGCCTGATGTGATTGTGCTCT) on px330 backbone, alongside mCherry-NLS plasmids. |